• Home
  • Ou Vit Elsa Dans L Reine Des Neiges

Ou Vit Elsa Dans L Reine Des Neiges

167  

Lab Reagents

Human IgG antibody Laboratories manufactures the ou vit elsa dans l reine des neiges reagents distributed by Genprice. The Ou Vit Elsa Dans L Reine Des Neiges reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact vitamin elisa. Other Ou products are available in stock. Specificity: Ou Category: Vit Group: Elsa Dans

Elsa Dans information

Rat Desmin (Des) ELISA Kit
RDR-Des-Ra-96Tests 96 Tests
EUR 742

Human Desmin (Des) ELISA Kit
RD-Des-Hu-48Tests 48 Tests
EUR 478

Human Desmin (Des) ELISA Kit
RD-Des-Hu-96Tests 96 Tests
EUR 662

Mouse Desmin (Des) ELISA Kit
RD-Des-Mu-48Tests 48 Tests
EUR 489

Mouse Desmin (Des) ELISA Kit
RD-Des-Mu-96Tests 96 Tests
EUR 677

Rat Desmin (Des) ELISA Kit
RD-Des-Ra-48Tests 48 Tests
EUR 511

Rat Desmin (Des) ELISA Kit
RD-Des-Ra-96Tests 96 Tests
EUR 709

VIT siRNA
20-abx939429
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

VIT siRNA
20-abx939430
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

VIT cloning plasmid
CSB-CL025862HU-10ug 10ug
EUR 663
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 1974
  • Sequence: ATGAGGACTGTTGTTCTCACTATGAAGGCATCTGTTATTGAAATGTTCCTTGTTTTGCTGGTGACTGGAGTACATTCAAACAAAGAAACGGCAAAGAAGATTAAAAGGCCCAAGTTCACTGTGCCTCAGATCAACTGCGATGTCAAAGCCGGAAAGATCATCGATCCTGAGTTCA
  • Show more
Description: A cloning plasmid for the VIT gene.

Vitrin (VIT) Antibody
abx037299-100ug 100 ug
EUR 391
  • Shipped within 5-10 working days.

Vitrin (VIT) Antibody
abx025749-400ul 400 ul
EUR 523
  • Shipped within 5-10 working days.

Vitrin (VIT) Antibody
abx025749-80l 80 µl
EUR 286
  • Shipped within 5-10 working days.

Mouse VIT shRNA Plasmid
20-abx978146
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human VIT shRNA Plasmid
20-abx953482
  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

VIT Recombinant Protein (Human)
RP044761 100 ug Ask for price

VIT Recombinant Protein (Mouse)
RP183824 100 ug Ask for price