- Home
- Ou Vit Elsa Dans L Reine Des Neiges
Lab Reagents
Human IgG antibody Laboratories manufactures the ou vit elsa dans l reine des neiges reagents distributed by Genprice. The Ou Vit Elsa Dans L Reine Des Neiges reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact vitamin elisa. Other Ou products are available in stock. Specificity: Ou Category: Vit Group: Elsa Dans
Elsa Dans information
Rat Desmin (Des) ELISA Kit |
RDR-Des-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 742 |
Human Desmin (Des) ELISA Kit |
RD-Des-Hu-48Tests |
Reddot Biotech |
48 Tests |
EUR 478 |
Human Desmin (Des) ELISA Kit |
RD-Des-Hu-96Tests |
Reddot Biotech |
96 Tests |
EUR 662 |
Mouse Desmin (Des) ELISA Kit |
RD-Des-Mu-48Tests |
Reddot Biotech |
48 Tests |
EUR 489 |
Mouse Desmin (Des) ELISA Kit |
RD-Des-Mu-96Tests |
Reddot Biotech |
96 Tests |
EUR 677 |
Rat Desmin (Des) ELISA Kit |
RD-Des-Ra-48Tests |
Reddot Biotech |
48 Tests |
EUR 511 |
Rat Desmin (Des) ELISA Kit |
RD-Des-Ra-96Tests |
Reddot Biotech |
96 Tests |
EUR 709 |
VIT siRNA |
20-abx939429 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VIT siRNA |
20-abx939430 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
VIT cloning plasmid |
CSB-CL025862HU-10ug |
Cusabio |
10ug |
EUR 663 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 1974
- Sequence: ATGAGGACTGTTGTTCTCACTATGAAGGCATCTGTTATTGAAATGTTCCTTGTTTTGCTGGTGACTGGAGTACATTCAAACAAAGAAACGGCAAAGAAGATTAAAAGGCCCAAGTTCACTGTGCCTCAGATCAACTGCGATGTCAAAGCCGGAAAGATCATCGATCCTGAGTTCA
- Show more
|
Description: A cloning plasmid for the VIT gene. |
Vitrin (VIT) Antibody |
abx037299-100ug |
Abbexa |
100 ug |
EUR 391 |
- Shipped within 5-10 working days.
|
Vitrin (VIT) Antibody |
abx025749-400ul |
Abbexa |
400 ul |
EUR 523 |
- Shipped within 5-10 working days.
|
Vitrin (VIT) Antibody |
abx025749-80l |
Abbexa |
80 µl |
EUR 286 |
- Shipped within 5-10 working days.
|
Mouse VIT shRNA Plasmid |
20-abx978146 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
Human VIT shRNA Plasmid |
20-abx953482 |
Abbexa |
|
|
- Shipped within 15-20 working days.
|
VIT Recombinant Protein (Human) |
RP044761 |
ABM |
100 ug |
Ask for price |
VIT Recombinant Protein (Mouse) |
RP183824 |
ABM |
100 ug |
Ask for price |