Lab Reagents
Cytoskeleton Inc Laboratories manufactures the cytoskelton of ell reagents distributed by Genprice. The Cytoskelton Of Ell reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Cytoskeleton Inc. Other Cytoskelton products are available in stock. Specificity: Cytoskelton Category: Of Group: Ell
Ell information
ELL siRNA |
20-abx915271 |
Abbexa |
|
|
- Shipped within 5-10 working days.
|
anti-ELL |
YF-PA15560 |
Abfrontier |
50 ul |
EUR 363 |
Description: Mouse polyclonal to ELL |
anti-ELL |
YF-PA25053 |
Abfrontier |
50 ul |
EUR 334 |
Description: Mouse polyclonal to ELL |
ELL Rabbit pAb |
A0668-100ul |
Abclonal |
100 ul |
EUR 308 |
ELL Rabbit pAb |
A0668-200ul |
Abclonal |
200 ul |
EUR 459 |
ELL Rabbit pAb |
A0668-20ul |
Abclonal |
20 ul |
Ask for price |
ELL Rabbit pAb |
A0668-50ul |
Abclonal |
50 ul |
Ask for price |
ELL Blocking Peptide |
DF3217-BP |
Affbiotech |
1mg |
EUR 195 |
ELL Conjugated Antibody |
C33821 |
SAB |
100ul |
EUR 397 |
ELL cloning plasmid |
CSB-CL007608HU-10ug |
Cusabio |
10ug |
EUR 233 |
- Formulation: 10 μg plasmid + 200μl Glycerol
- Length: 267
- Sequence: atgacttggaaaggtggtggggggtggatggcggctgtgactcagggcccagggatcacatgggggtcactgctgccatcagcagtcaggcagggagaacagaaatgcaaaaatacagatgtctatttttctaaactggggggtggaggggtgcctcctgacagcttccaaagagc
- Show more
|
Description: A cloning plasmid for the ELL gene. |
ELL Rabbit pAb |
A16448-100ul |
Abclonal |
100 ul |
EUR 308 |
ELL Rabbit pAb |
A16448-200ul |
Abclonal |
200 ul |
EUR 459 |
ELL Rabbit pAb |
A16448-20ul |
Abclonal |
20 ul |
EUR 183 |
ELL Rabbit pAb |
A16448-50ul |
Abclonal |
50 ul |
EUR 223 |
ELL Rabbit pAb |
A16449-100ul |
Abclonal |
100 ul |
EUR 308 |
ELL Rabbit pAb |
A16449-200ul |
Abclonal |
200 ul |
EUR 459 |