Cytoskelton Of Ell

Lab Reagents

Cytoskeleton Inc Laboratories manufactures the cytoskelton of ell reagents distributed by Genprice. The Cytoskelton Of Ell reagent is RUO (Research Use Only) to test human serum or cell culture lab samples. To purchase these products, for the MSDS, Data Sheet, protocol, storage conditions/temperature or for the concentration, please contact Cytoskeleton Inc. Other Cytoskelton products are available in stock. Specificity: Cytoskelton Category: Of Group: Ell

Ell information

ELL siRNA

20-abx915271
  • EUR 551.00
  • EUR 732.00
  • 15 nmol
  • 30 nmol
  • Shipped within 5-10 working days.

ELL Antibody

ABD3217 100 ug
EUR 438

anti-ELL

YF-PA15560 50 ul
EUR 363
Description: Mouse polyclonal to ELL

anti-ELL

YF-PA25053 50 ul
EUR 334
Description: Mouse polyclonal to ELL

ELL Rabbit pAb

A0668-100ul 100 ul
EUR 308

ELL Rabbit pAb

A0668-200ul 200 ul
EUR 459

ELL Rabbit pAb

A0668-20ul 20 ul Ask for price

ELL Rabbit pAb

A0668-50ul 50 ul Ask for price

ELL Blocking Peptide

DF3217-BP 1mg
EUR 195

ELL Conjugated Antibody

C33821 100ul
EUR 397

ELL cloning plasmid

CSB-CL007608HU-10ug 10ug
EUR 233
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 267
  • Sequence: atgacttggaaaggtggtggggggtggatggcggctgtgactcagggcccagggatcacatgggggtcactgctgccatcagcagtcaggcagggagaacagaaatgcaaaaatacagatgtctatttttctaaactggggggtggaggggtgcctcctgacagcttccaaagagc
  • Show more
Description: A cloning plasmid for the ELL gene.

ELL Rabbit pAb

A16448-100ul 100 ul
EUR 308

ELL Rabbit pAb

A16448-200ul 200 ul
EUR 459

ELL Rabbit pAb

A16448-20ul 20 ul
EUR 183

ELL Rabbit pAb

A16448-50ul 50 ul
EUR 223

ELL Rabbit pAb

A16449-100ul 100 ul
EUR 308

ELL Rabbit pAb

A16449-200ul 200 ul
EUR 459